Phocid herpes virus type 1


EVAg

Produced by
: ERASMUS-MC
Shipping From
: Rotterdam - NL

Product Description

Ref-SKU:
011V-00884
Virus culture stock of Phocid Herpes Virus type 1 (PhHV-1) to be used for research or an internal NAT DNA control
Product Risk Group: 
Isolate: 
PB84
Genotype: 
1

Storage conditions: 
Viral Storage Medium -80C
Sequencing: 
Partial sequence
Infectivity: 
Infectivity tested
Mycoplasmic content: 
Mycoplasma free

Unit definition: 
500 µL culture supernatant

In stock

500,00 €
(Cost per access for Academics)

catalogue

biobank

Portal

EVAg

purchase

buy

order

price

cost

shipping

shipment

experiment

research

laboratory

viral

virus

GMO: 
No
Biosafety restrictions: 
BSL2
Infectivity Test: 
virus culture
Production cell line: 
Genbank reference: 
Geographical origin: 
Isolation host: 
Isolation technique: 
virus culture using CrFK cells
Isolation conditions: 
See: Harder T.C. et.al; J.Gen.Virol. (1996) 77, 27-35
Passage: 
7
Identification technique: 
partial sequencing and Real Time PCR
Technical recommendation: 
The Primer/Probe mix is ready to use 1 µl per 50µl PCR reaction. The PhHV-1 Stock can be diluted 1000 times in PBS/DMEM, in our real time PCR assay the Ct-value is approx. Ct28. For the isolation we use 190 µl plasma or serum, and 10 µl of the diluted PhHV-1 (200ul total input volume). Elution takes place in 100 µl, and 20 µl of this eluate is used for real time PCR assay, Final volume of the real time PCR reaction is 50 µl. (25 µl 2X UMM (Lifetechnologies), 1 µl Primer/Probe mix, 4 µl H2O, 20 µl eluate) PCR parameters : Virus: PHHV Target: gB-gen Product: 89 bp Reaction conditions: 2' 52°C/10' 94°C/15" 95°C, 1' 60°C, 42 cycli Sequence 5’-3’: probe 5'CY5 tttttatgtgtccgccaccatctggatc-MGB CONC: 5 pmol/µl Primer-fwd gggcgaatcacagattgaatc CONC: 2.5 pmol/µl Primer-rev gcggttccaaacgtaccaa CONC: 10 pmol/µl Our PhHV probe is currently labeled with Cy5-MGB-2 but other labels can also be used. Cell Culture: Culture on CRFK-cells in DMEM medium (CRFK = Crandel Reed Feline Kidney), continuous cell-line. (One ampoule CRFK-cells is enough for culture flask of 162 cm2 . (Splitratio 1:10 weekly) DMEM medium containing : - 500 ml DMEM BioWhittaker (Cambrex) BE SP070F(4,5 g/l glucose) - 5.7 ml NaHCO3 (7,5%) BioWhittaker (Cambrex) BE17-613E(0.85 g/l 20 mM) - 10 ml 1M Hepes - 5 ml 200mM L-Glutamine - 5 ml 10000 U/ml or 10000 µg/ml Penicilline/Streptomycine - 50 ml FBS for growth medium or 5 ml FBS for maintenance medium - 5 ml Amphotericine in maintenance medium Culture at 36.5°C for about one week. No CO2 conditions. PhHV virus infection/culture:  Discard the maintenance medium of one monolayer CrFK cells culture flask (162 cm2).  Dilute one ampoule (1ml) 1000x concentrated PhHV virus stock with 4 ml maintenance medium and apply to the monolayer CRFK cells for infection.  Incubate 1 hour at 37°C and remove the virus from the cells.  Add 40 ml maintenance medium and incubate at 37°C.  Check for CPE (herpes-like) once a week and change medium once a week. If CPE is present, the Ct value of supernatant can be determined with real time PCR.  Culture for as long as needed to obtain a satisfying concentration/stock, the harvest all supernatant, centrifuge to lose cell debris (5 min 1200xg).  Aliquot and store cultured virus at -80°C.