MERS-CoV (hCoV-EMC) upstream E (upE) assay Kit


EVAg

Produced by
: CUB
Shipping From
: Berlin - DE

Product Description

Ref-SKU:
004K-02175
Real time detection kit for MERS CoV targeting the envelope gene (upE) that contains positive control, primers and probe.
Product Risk Group: 

Information on the related virus

Virus name: 


Unit definition: 
50 reactions

In stock

436,00 €
(Cost per access for Academics)

catalogue

biobank

Portal

EVAg

purchase

buy

order

price

cost

shipping

shipment

experiment

research

laboratory

viral

virus

Can it be used to produce GMO: 
No
Shipping conditions: 
Room Temperature
IATA Classification: 
NON DANGEROUS GOODS
Storage conditions: 
Nuclease-Free Water -80C
Targeted region: 
CTTCTCATGGTATGGTCCCTGTAATACACACCAAACCATTATTTATTAGAAACTTCGATCAGCGTTGCAGCTGTTCTCGTTGTTTTTATTTGCACTCTTCCACTTATATAGAGTGCACTTATATTAGCCGTTTTAGTAAGATTAGCCTAGTTTCTGTAACTGACTTCTCCTTAAACGGCAATGTTTCCACTGTTTTCGTGCCTGCAACGCGCGATTCAGTTCCTCTTCACATAATCGCCCCGAGCTCGCTTATCGTTTAAGCAGCTCTGCGCTACTATGGGTCCCGTGTAGAGGCTAATCCATTAGTCTCTCTTTGGACATATGGAAAACGAACTATGTTACCCTTTGTCCAAGAACGAATAGGGTTGTTCATAGTAAACTTTTTCATTTTTACCGTAGTATGTGCTATAACACTCTTGGTGTGTATGGCTT
Technical recommendation: 
Additional Reagents needed (not supplied): - Invitrogen SuperScript III OneStep RT-PCR System mit Platinum Taq, #12574-026 - Roche BSA (20 mg/ml), #10711454001 - MgSO4 (50mM)
Specificity documented: 
No
Virus host type: 

Comments (1)

  • Westfalia's picture

    Dear EVAg team,

    I hope my email finds you well!

    I would be grateful if you could send us a quote on EXW terms for the following items:

    MERS-CoV (hCoV-EMC) upstream E (upE) assay Kit – 1pcs

    In addition, would you please also advise whether the product is available in stock?
    Please advise as well the following:
    - Product’s storage and transportation conditions
    - Product’s expiry date, and the shelf life
    - HS code,
    - Estimated delivery time

    Many thanks in advance and I am looking forward to your proposal!

    Feb 02, 2021