
- Tagged as
- - Molecular detection kit
- - Derived product
- - Detection Kit (for RUO)
Produced by
: CUB Shipping From
: Berlin - DE
Product Description
Ref-SKU:
004K-02175 Real time detection kit for MERS CoV targeting the envelope gene (upE) that contains positive control, primers and probe.
Product Risk Group:
Information on the related virus
ICTV Taxonomy:
Virus name:
Can it be used to produce GMO:
No
Shipping conditions:
Room Temperature
IATA Classification:
NON DANGEROUS GOODS
Storage conditions:
Nuclease-Free Water -80C
Targeted region:
CTTCTCATGGTATGGTCCCTGTAATACACACCAAACCATTATTTATTAGAAACTTCGATCAGCGTTGCAGCTGTTCTCGTTGTTTTTATTTGCACTCTTCCACTTATATAGAGTGCACTTATATTAGCCGTTTTAGTAAGATTAGCCTAGTTTCTGTAACTGACTTCTCCTTAAACGGCAATGTTTCCACTGTTTTCGTGCCTGCAACGCGCGATTCAGTTCCTCTTCACATAATCGCCCCGAGCTCGCTTATCGTTTAAGCAGCTCTGCGCTACTATGGGTCCCGTGTAGAGGCTAATCCATTAGTCTCTCTTTGGACATATGGAAAACGAACTATGTTACCCTTTGTCCAAGAACGAATAGGGTTGTTCATAGTAAACTTTTTCATTTTTACCGTAGTATGTGCTATAACACTCTTGGTGTGTATGGCTT
Technical recommendation:
Additional Reagents needed (not supplied):
- Invitrogen SuperScript III OneStep RT-PCR System mit Platinum Taq, #12574-026
- Roche BSA (20 mg/ml), #10711454001
- MgSO4 (50mM)
Specificity documented:
No
SOP File:
Virus host type:
Comments (1)
Dear EVAg team,
I hope my email finds you well!
I would be grateful if you could send us a quote on EXW terms for the following items:
MERS-CoV (hCoV-EMC) upstream E (upE) assay Kit – 1pcs
In addition, would you please also advise whether the product is available in stock?
Please advise as well the following:
- Product’s storage and transportation conditions
- Product’s expiry date, and the shelf life
- HS code,
- Estimated delivery time
Many thanks in advance and I am looking forward to your proposal!