MERS-CoV (hCoV-EMC) upstream E (upE) assay Kit


EVAg

Produced by
: CUB
Shipping From
: Berlin - DE

Product Description

Ref-SKU:
004K-02175
Real time detection kit for MERS CoV targeting the envelope gene (upE) that contains positive control, primers and probe.
Product Risk Group: 

Information on the related virus

Virus name: 


Unit definition: 
50 reactions

In stock

436,00 €
(Cost per access for Academics)

catalogue

biobank

Portal

EVAg

purchase

buy

order

price

cost

shipping

shipment

experiment

research

laboratory

viral

virus

Can it be used to produce GMO: 
No
Storage conditions: 
Nuclease-Free Water -80C
Targeted region: 
CTTCTCATGGTATGGTCCCTGTAATACACACCAAACCATTATTTATTAGAAACTTCGATCAGCGTTGCAGCTGTTCTCGTTGTTTTTATTTGCACTCTTCCACTTATATAGAGTGCACTTATATTAGCCGTTTTAGTAAGATTAGCCTAGTTTCTGTAACTGACTTCTCCTTAAACGGCAATGTTTCCACTGTTTTCGTGCCTGCAACGCGCGATTCAGTTCCTCTTCACATAATCGCCCCGAGCTCGCTTATCGTTTAAGCAGCTCTGCGCTACTATGGGTCCCGTGTAGAGGCTAATCCATTAGTCTCTCTTTGGACATATGGAAAACGAACTATGTTACCCTTTGTCCAAGAACGAATAGGGTTGTTCATAGTAAACTTTTTCATTTTTACCGTAGTATGTGCTATAACACTCTTGGTGTGTATGGCTT
Technical recommendation: 
Additional Reagents needed (not supplied): - Invitrogen SuperScript III OneStep RT-PCR System mit Platinum Taq, #12574-026 - Roche BSA (20 mg/ml), #10711454001 - MgSO4 (50mM)
Specificity documented: 
No
Shipping conditions: 
Dry ice
IATA Classification: 
NON DANGEROUS GOODS