Human 2019-nCoV strain 2019-nCoV/Italy-INMI1 RNA


EVAg

Produced by
: INMI
Shipping From
: Roma - IT

Product Description

Ref-SKU:
008N-03894
RNA of Human 2019-nCoV strain 2019-nCoV/Italy-INMI1. The RNA was obtained from a viral strain isolated in Italy, from a sample collected in January 29, 2020. To confirm its identity the virus has been completely sequenced. The complete sequence was submitted to GenBank (SARS-CoV-2/INMI1-Isolate/2020/Italy: MT066156) and is available on GISAID website (BetaCoV/Italy/INMI1-isl/2020: EPI_ISL_410545) upon registration. Import permit can be needed in your country. If yes, please indicate it in your online enquiry.
Product Risk Group: 

Information on the related virus

Virus name: 


Unit definition: 
1 vial = 0.1 ml

In stock

500,00 €
(Cost per access for Academics)

catalogue

biobank

Portal

EVAg

purchase

buy

order

price

cost

shipping

shipment

experiment

research

laboratory

viral

virus

Cloned Product: No
Can it be used to produce GMO: 
No
Sequencing: 
Fully sequenced
Sequence controlled: 
Yes
Mutations: 
Contain mutations (no frameshift, no unexpected STOP codon)
Observed mutations: 
Mutations compared to the Wuhan-Hu-1/2019 sequence as reference are described in a submitted paper.
Identification technique: 
PCR and sequencing
Titer: 
10^6 cp/uL
Storage conditions: 
Nuclease-Free Water -80C
Shipping conditions: 
IATA Classification: 
Note: 

Preparation of SARS-CoV-2 strain 2019-nCoV/Italy-INMI1 RNA

700 ul of RNA was extracted from cell culture supernatant containing SARS-CoV-2 strain 2019-nCoV/Italy-INMI1 grown on Vero E6 cells (viral titer: 10^7.25 TCID50/ml) with the viral RNA mini kit (QIAGEN, Hilden, Germany).
5ul of the extract were tested and quantified by one step real-time RT-PCR using a standard curve prepared through serial dilutions of the Wuhan coronavirus 2019 E gene control (EVAG Ref-SKU: 026N-03866) (Corman et al 2020).

Primers and probe:
E gene    E_Sarbeco_F       ACAGGTACGTTAATAGTTAATAGCGT
              E_Sarbeco_P1     FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ
              E_Sarbeco_R       ATATTGCAGCAGTACGCACACA

E gene assay:
Mastermix     
H2O RNAse free                               3.6 ul
2x Reaction mix                               12.5 ul
MgSO4 (50mM)                                0.4 ul
Primer Fwd (10uM)                           1 ul
Primer Rev (10uM)                            1 ul
Probe (10uM)                                    0.5 ul
SuperScript® III/Platinum® Taq Mix   1 ul
Total volume                                     20 ul + 5 ul RNA template

Reagents
SuperScript™ III Platinum™ One-Step qRT-PCR Kit Invitrogen SuperScript III OneStep RT-PCR System

RotorGene cycling conditions
55°C        10’
94°C        3’
45 cycles
94°C        15’’
58°C        60’’  single step read F. (530 nm)

The extract was diluited in H2O RNAse free containing Carrier-RNA (Qiagen, C=10 µg/ml) to obtain the final concentration of 10^6 cp/uL (10^5.85 cp/uL).

References:
Corman VM, Landt O, Kaiser M, Molenkamp R, Meijer A, Chu DKW, Bleicker T, Brünink S, Schneider J, Schmidt ML, Mulders DGJC, Haagmans BL, van der Veer B, van den Brink S, Wijsman L, Goderski G, Romette JL, Ellis J, Zambon M, Peiris M,  Goossens H, Reusken C, Koopmans MPG, Drosten C. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Euro Surveill. 2020 Jan;25(3). doi: 10.2807/1560-7917.ES.2020.25.3.2000045. PubMed PMID: 31992387; PubMed Central PMCID: PMC6988269.